kanamycin

Summary

Summary: Antibiotic complex produced by Streptomyces kanamyceticus from Japanese soil. Comprises 3 components: kanamycin A, the major component, and kanamycins B and C, the minor components.

Top Publications

  1. Ohlemiller K, Rybak Rice M, Rosen A, Montgomery S, Gagnon P. Protection by low-dose kanamycin against noise-induced hearing loss in mice: dependence on dosing regimen and genetic background. Hear Res. 2011;280:141-7 pubmed publisher
    We recently demonstrated that sub-chronic low-dose kanamycin (KM, 300 mg/kg sc, 2×/day, 10 days) dramatically reduces permanent noise-induced hearing loss (NIHL) and hair cell loss in 1 month old CBA/J mice (Fernandez et al., 2010, J...
  2. Nepal K, Oh T, Sohng J. Heterologous production of paromamine in Streptomyces lividans TK24 using kanamycin biosynthetic genes from Streptomyces kanamyceticus ATCC12853. Mol Cells. 2009;27:601-8 pubmed publisher
    The 2-deoxystreptamine and paromamine are two key intermediates in kanamycin biosynthesis...
  3. Burris K, Mentewab A, Ripp S, Stewart C. An Arabidopsis thaliana ABC transporter that confers kanamycin resistance in transgenic plants does not endow resistance to Escherichia coli. Microb Biotechnol. 2008;1:191-5 pubmed publisher
    ..in origin, but it has been recently shown that an Arabidopsis thaliana ABC transporter, Atwbc19, confers kanamycin resistance when overexpressed in transgenic plants...
  4. Versnel H, Agterberg M, de Groot J, Smoorenburg G, Klis S. Time course of cochlear electrophysiology and morphology after combined administration of kanamycin and furosemide. Hear Res. 2007;231:1-12 pubmed
    ..the variability of cochlear function between and within guinea pigs after combined administration of kanamycin and furosemide. Concurrently, histological data were obtained at 1, 2, 4 and 8 weeks after deafening treatment...
  5. Georghiou S, Magaña M, Garfein R, Catanzaro D, Catanzaro A, Rodwell T. Evaluation of genetic mutations associated with Mycobacterium tuberculosis resistance to amikacin, kanamycin and capreomycin: a systematic review. PLoS ONE. 2012;7:e33275 pubmed publisher
    ..and isoniazid, it is less well-studied and understood for second-line, injectable drugs, amikacin (AMK), kanamycin (KAN) and capreomycin (CAP)...
  6. Zhu Y, Chandra P, Song K, Ban C, Shim Y. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite. Biosens Bioelectron. 2012;36:29-34 pubmed publisher
    Highly sensitive label-free detection of kanamycin is achieved with an aptamer sensor based on a conducting polymer/gold self-assembled nanocomposite...
  7. Kitahara T, Li Korotky H, Balaban C. Regulation of mitochondrial uncoupling proteins in mouse inner ear ganglion cells in response to systemic kanamycin challenge. Neuroscience. 2005;135:639-53 pubmed
    ..uncoupling protein expression is up-regulated in response to the reactive oxygen species challenge imposed by kanamycin and antioxidant (2,3-dihydroxybenzoate) treatment in mice...
  8. Salian S, Matt T, Akbergenov R, Harish S, Meyer M, Duscha S, et al. Structure-activity relationships among the kanamycin aminoglycosides: role of ring I hydroxyl and amino groups. Antimicrob Agents Chemother. 2012;56:6104-8 pubmed publisher
    ..form an important subgroup of the 4,6-disubstituted 2-deoxystreptamine aminoglycoside antibiotics, comprising kanamycin A, kanamycin B, tobramycin, and dibekacin...
  9. Feng Y, Liu S, Wang Q, Wang L, Tang S, Wang J, et al. Rapid diagnosis of drug resistance to fluoroquinolones, amikacin, capreomycin, kanamycin and ethambutol using genotype MTBDRsl assay: a meta-analysis. PLoS ONE. 2013;8:e55292 pubmed publisher
    ..to synthesize the latest data on the diagnostic accuracy of GenoType MTBDRsl in detecting drug resistance to fluoroquinolones, amikacin, capreomycin, kanamycin and ethambutol, in comparison with the phenotypic drug susceptibility test.

More Information

Publications62

  1. Wise A, Richardson R, Hardman J, Clark G, O Leary S. Resprouting and survival of guinea pig cochlear neurons in response to the administration of the neurotrophins brain-derived neurotrophic factor and neurotrophin-3. J Comp Neurol. 2005;487:147-65 pubmed
    ..These findings have significant implications for an improvement in the performance of the cochlear implant and for future therapies to restore hearing to the deaf. ..
  2. Aminova O, Paul D, Childs Disney J, Disney M. Two-dimensional combinatorial screening identifies specific 6'-acylated kanamycin A- and 6'-acylated neamine-RNA hairpin interactions. Biochemistry. 2008;47:12670-9 pubmed publisher
    Herein, we report the RNA hairpin loops from a six-nucleotide hairpin library that bind 6'-acylated kanamycin A (1) and 6'-acylated neamine (2) identified by two-dimensional combinatorial screening (2DCS)...
  3. Anantharaman A, Rizvi M, Sahal D. Synergy with rifampin and kanamycin enhances potency, kill kinetics, and selectivity of de novo-designed antimicrobial peptides. Antimicrob Agents Chemother. 2010;54:1693-9 pubmed publisher
    ..potencies and kill kinetics improved significantly in all of these aspects when synergized with rifampin and kanamycin against Escherichia coli...
  4. Tran T, Disney M. Molecular recognition of 6'-N-5-hexynoate kanamycin A and RNA 1x1 internal loops containing CA mismatches. Biochemistry. 2011;50:962-9 pubmed publisher
    ..to identify the RNA internal loops that bind an aminoglycoside derivative, we determined that 6'-N-5-hexynoate kanamycin A prefers to bind 1x1 nucleotide internal loops containing C·A mismatches...
  5. Taylor R, Nevill G, Forge A. Rapid hair cell loss: a mouse model for cochlear lesions. J Assoc Res Otolaryngol. 2008;9:44-64 pubmed
    ..pattern and extent of cochlear lesions rapidly induced with a combination of a single dose of aminoglycoside (kanamycin) followed by a loop diuretic (bumetanide)...
  6. Kitahara T, Li H, Balaban C. Changes in transient receptor potential cation channel superfamily V (TRPV) mRNA expression in the mouse inner ear ganglia after kanamycin challenge. Hear Res. 2005;201:132-44 pubmed
    ..track changes in TRPV1-4 mRNA expression in the spiral, vestibular, and trigeminal ganglia and the kidney from kanamycin (KM)-treated mice...
  7. Disney M, Childs Disney J. Using selection to identify and chemical microarray to study the RNA internal loops recognized by 6'-N-acylated kanamycin A. Chembiochem. 2007;8:649-56 pubmed
    ..We selected members of an RNA 3x3 internal loop motif library that bind kanamycin A, an RNA-binding aminoglycoside antibiotic, by using only one round of selection...
  8. Bremer H, de Groot J, Versnel H, Klis S. Combined administration of kanamycin and furosemide does not result in loss of vestibular function in Guinea pigs. Audiol Neurootol. 2012;17:25-38 pubmed publisher
    ..The aim of our study was to investigate the effect of co-administration of kanamycin and furosemide upon the otolith organs and to compare it to the known vestibulotoxic effect of gentamicin...
  9. Moodley P, Shah N, Tayob N, Connolly C, Zetola N, Gandhi N, et al. Spread of extensively drug-resistant tuberculosis in KwaZulu-Natal province, South Africa. PLoS ONE. 2011;6:e17513 pubmed publisher
    ..KZN is divided into 11 healthcare districts. We sought to determine the distribution of XDR TB cases in the province in relation to population density...
  10. Travis R, Gyles C, Reid Smith R, Poppe C, McEwen S, Friendship R, et al. Chloramphenicol and kanamycin resistance among porcine Escherichia coli in Ontario. J Antimicrob Chemother. 2006;58:173-7 pubmed
    The purpose of this study was to compare the distribution of chloramphenicol and kanamycin resistance genes across three populations of porcine Escherichia coli...
  11. Said H, Kock M, Ismail N, Baba K, Omar S, Osman A, et al. Evaluation of the GenoType® MTBDRsl assay for susceptibility testing of second-line anti-tuberculosis drugs. Int J Tuberc Lung Dis. 2012;16:104-9 pubmed publisher
    ..The GenoType® MTBDRsl assay is a new rapid assay for the detection of resistance to second-line anti-tuberculosis drugs...
  12. Jiang H, Sha S, Forge A, Schacht J. Caspase-independent pathways of hair cell death induced by kanamycin in vivo. Cell Death Differ. 2006;13:20-30 pubmed
    ..We investigated cell death pathways in a mouse model of progressive kanamycin-induced hair cell loss...
  13. Hu B, Zhang L, Chen X, Wang J. Gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAu(rod)) nanocapsules for drug delivery and photothermal therapy on bacteria. Nanoscale. 2013;5:246-52 pubmed publisher
    A hybrid bactericidal material, gold nanorod-covered kanamycin-loaded hollow SiO(2) (HSKAu(rod)) nanocapsules, is constructed...
  14. Engström A, Perskvist N, Werngren J, Hoffner S, Jureen P. Comparison of clinical isolates and in vitro selected mutants reveals that tlyA is not a sensitive genetic marker for capreomycin resistance in Mycobacterium tuberculosis. J Antimicrob Chemother. 2011;66:1247-54 pubmed publisher
    ..and drug-resistance mechanisms for the cyclic peptide capreomycin and the aminoglycosides amikacin and kanamycin by comparing genotypes and phenotypes of clinical isolates and in vitro selected mutants of Mycobacterium ..
  15. Du Q, Dai G, Long Q, Yu X, Dong L, Huang H, et al. Mycobacterium tuberculosis rrs A1401G mutation correlates with high-level resistance to kanamycin, amikacin, and capreomycin in clinical isolates from mainland China. Diagn Microbiol Infect Dis. 2013;77:138-42 pubmed publisher
    ..correlating phenotypic resistance level with the injectable second-line anti-tuberculosis drugs (SLDs) including kanamycin (KAN), amikacin (AMK), and capreomycin (CAP) remain elusive...
  16. Campbell P, Morlock G, Sikes R, Dalton T, Metchock B, Starks A, et al. Molecular detection of mutations associated with first- and second-line drug resistance compared with conventional drug susceptibility testing of Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2011;55:2032-41 pubmed publisher
    ..RIF), pyrazinamide (PZA), and ethambutol (EMB) and the second-line drugs amikacin (AMK), capreomycin (CAP), kanamycin (KAN), ciprofloxacin (CIP), and ofloxacin (OFX)...
  17. Park J, Park S, Nepal K, Han A, Ban Y, Yoo Y, et al. Discovery of parallel pathways of kanamycin biosynthesis allows antibiotic manipulation. Nat Chem Biol. 2011;7:843-52 pubmed publisher
    b>Kanamycin is one of the most widely used antibiotics, yet its biosynthetic pathway remains unclear. Current proposals suggest that the kanamycin biosynthetic products are linearly related via single enzymatic transformations...
  18. Hirose K, Sato E. Comparative analysis of combination kanamycin-furosemide versus kanamycin alone in the mouse cochlea. Hear Res. 2011;272:108-16 pubmed publisher
    ..comparison of hearing thresholds, hair cell damage and monocyte migration into the mouse cochlea after kanamycin versus combined kanamycin/furosemide and explore the pathophysiology of enhanced hair cell loss in ..
  19. Chen C, Lindsey R, Strobaugh T, Frye J, Meinersmann R. Prevalence of ColE1-like plasmids and kanamycin resistance genes in Salmonella enterica serovars. Appl Environ Microbiol. 2010;76:6707-14 pubmed publisher
    ..in assessing the prevalence of the isolates harboring ColE1-like plasmids carrying the aph gene responsible for kanamycin resistance (Kan(r)) phenotypes, 102 Kan(r) Salmonella isolates collected through the National Antimicrobial ..
  20. Zaunbrecher M, Sikes R, Metchock B, Shinnick T, Posey J. Overexpression of the chromosomally encoded aminoglycoside acetyltransferase eis confers kanamycin resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A. 2009;106:20004-9 pubmed publisher
    ..The aminoglycosides kanamycin and amikacin are important bactericidal drugs used to treat MDR TB, and resistance to one or both of these drugs ..
  21. Yanai K, Murakami T, Bibb M. Amplification of the entire kanamycin biosynthetic gene cluster during empirical strain improvement of Streptomyces kanamyceticus. Proc Natl Acad Sci U S A. 2006;103:9661-6 pubmed
    Streptomyces kanamyceticus 12-6 is a derivative of the wild-type strain developed for industrial kanamycin (Km) production...
  22. Agterberg M, Versnel H, de Groot J, Smoorenburg G, Albers F, Klis S. Morphological changes in spiral ganglion cells after intracochlear application of brain-derived neurotrophic factor in deafened guinea pigs. Hear Res. 2008;244:25-34 pubmed publisher
    ..Guinea pigs were deafened with a subcutaneous injection of kanamycin followed by intravenous infusion of furosemide...
  23. Rommens C. Kanamycin resistance in plants: an unexpected trait controlled by a potentially multifaceted gene. Trends Plant Sci. 2006;11:317-9 pubmed
    Ayalew Mentewab and C. Neal Stewart Jr recently showed that an Arabidopsis kanamycin resistance gene encodes an ATP binding cassette (ABC) transporter...
  24. Kohanski M, Dwyer D, Hayete B, Lawrence C, Collins J. A common mechanism of cellular death induced by bactericidal antibiotics. Cell. 2007;130:797-810 pubmed
    ..g., reca. ..
  25. Maus C, Plikaytis B, Shinnick T. Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2005;49:3192-7 pubmed
    Capreomycin, kanamycin, amikacin, and viomycin are drugs that are used to treat multidrug-resistant tuberculosis. Each inhibits translation, and cross-resistance to them is a concern during therapy...
  26. Sainlos M, Hauchecorne M, Oudrhiri N, Zertal Zidani S, Aissaoui A, Vigneron J, et al. Kanamycin A-derived cationic lipids as vectors for gene transfection. Chembiochem. 2005;6:1023-33 pubmed
    ..The encouraging results obtained with a first cholesterol derivative of kanamycin A prompted us to investigate this family of vectors further, by modulating the constituent structural units of ..
  27. Peng X, Xu C, Ren H, Lin X, Wu L, Wang S. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Pseudomonas aeruginosa responding to ampicilin, kanamycin, and tetracycline resistance. J Proteome Res. 2005;4:2257-65 pubmed
    ..aeruginosa responding to ampicilin, kanamycin and tetracycline resistances...
  28. Song K, Cho M, Jo H, Min K, Jeon S, Kim T, et al. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer. Anal Biochem. 2011;415:175-81 pubmed publisher
    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads...
  29. Thapa L, Oh T, Lee H, Liou K, Park J, Yoon Y, et al. Heterologous expression of the kanamycin biosynthetic gene cluster (pSKC2) in Streptomyces venezuelae YJ003. Appl Microbiol Biotechnol. 2007;76:1357-64 pubmed
    ..32 kb and 28 open-reading frames, was isolated from Streptomyces kanamyceticus ATCC12853 as the gene cluster of kanamycin. This gene cluster includes the minimal biosynthetic genes of kanamycin with the resistance and regulatory genes...
  30. Lee J, Pradhan J, Maskey D, Park K, Hong S, Suh M, et al. Glutamate co-transmission from developing medial nucleus of the trapezoid body--lateral superior olive synapses is cochlear dependent in kanamycin-treated rats. Biochem Biophys Res Commun. 2011;405:162-7 pubmed publisher
    ..MNTB)--the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8...
  31. Fan G, Yin Z, Sun Y, Chen S, Zhang W, Huang X, et al. Reversible neurotoxicity of kanamycin on dorsal cochlear nucleus. Brain Res. 2013;1502:30-46 pubmed publisher
    ..nucleus (DCN) and investigated whether apoptosis or autophagy was upregulated in the neurotoxic course of kanamycin on DCN after kanamycin treatment...
  32. Prasad R, Verma S, Sahai S, Kumar S, Jain A. Efficacy and safety of kanamycin, ethionamide, PAS and cycloserine in multidrug-resistant pulmonary tuberculosis patients. Indian J Chest Dis Allied Sci. 2006;48:183-6 pubmed
    We carried out this study to determine the efficacy and safety of a regimen containing kanamycin, ethionamide, isoniazid, para-aminosalicylic acid (PAS) and cycloserine in the treatment of multidrug-resistant tuberculosis (MDR-TB)...
  33. Song C, Gao N, Gao H. Transmembrane distribution of kanamycin and chloramphenicol: insights into the cytotoxicity of antibacterial drugs. Mol Biosyst. 2010;6:1901-10 pubmed publisher
    ..antibiotics, zebrafish (Danio rerio) embryos and larvae were exposed to two structurally different antibiotics, kanamycin (KAN) and chloramphenicol (CAP)...
  34. Kong W, Yin Z, Fan G, Li D, Huang X. Time sequence of auditory nerve and spiral ganglion cell degeneration following chronic kanamycin-induced deafness in the guinea pig. Brain Res. 2010;1331:28-38 pubmed publisher
    ..sequence of morphological changes of the spiral ganglion cell (SGC) and auditory nerve (AN) following chronic kanamycin-induced deafness...
  35. Fernandez E, Ohlemiller K, Gagnon P, Clark W. Protection against noise-induced hearing loss in young CBA/J mice by low-dose kanamycin. J Assoc Res Otolaryngol. 2010;11:235-44 pubmed publisher
    Animal studies indicate that a combination of kanamycin (KM) and noise produces a synergistic effect, whereby the threshold shift from the combination is greater than the sum of the shifts caused by either agent alone...
  36. Jugheli L, Bzekalava N, De Rijk P, Fissette K, Portaels F, Rigouts L. High level of cross-resistance between kanamycin, amikacin, and capreomycin among Mycobacterium tuberculosis isolates from Georgia and a close relation with mutations in the rrs gene. Antimicrob Agents Chemother. 2009;53:5064-8 pubmed publisher
    The aminoglycosides kanamycin and amikacin and the macrocyclic peptide capreomycin are key drugs for the treatment of multidrug-resistant tuberculosis (MDR-TB)...
  37. Dubos C, Willment J, Huggins D, Grant G, Campbell M. Kanamycin reveals the role played by glutamate receptors in shaping plant resource allocation. Plant J. 2005;43:348-55 pubmed
    ..The data show that aminoglycoside antibiotics, such as kanamycin, and polyamines impinge upon this circuit...
  38. Jin S, Mann J. Synthetic neomycin-kanamycin phosphotransferase, type II coding sequence for gene targeting in mammalian cells. Genesis. 2005;42:207-9 pubmed
    The bacterial neomycin-kanamycin phosphotransferase, type II enzyme is encoded by the neo gene and confers resistance to aminoglycoside drugs such as neomycin and kanamycin-bacterial selection and G418-eukaryotic cell selection...
  39. Mentewab A, Stewart C. Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants. Nat Biotechnol. 2005;23:1177-80 pubmed
    Selectable markers of bacterial origin such as the neomycin phosphotransferase type II gene, which can confer kanamycin resistance to transgenic plants, represent an invaluable tool for plant engineering...
  40. Yu S, Wei Q, Du B, Wu D, Li H, Yan L, et al. Label-free immunosensor for the detection of kanamycin using Ag@Fe?O? nanoparticles and thionine mixed graphene sheet. Biosens Bioelectron. 2013;48:224-9 pubmed publisher
    A highly sensitive label-free immunosensor for the detection of kanamycin had been developed using silver hybridized mesoporous ferroferric oxide nanoparticles (Ag@Fe?O? NPs) and thionine mixed graphene sheet (TH-GS)...
  41. Wang J, Li J, Chen H, Chang H, Tanifum C, Liu H, et al. Glycodiversification for the optimization of the kanamycin class aminoglycosides. J Med Chem. 2005;48:6271-85 pubmed
    In an effort to optimize the antibacterial activity of kanamycin class aminoglycoside antibiotics, we have accomplished the synthesis and antibacterial assay of new kanamycin B analogues...
  42. Jiang H, Sha S, Schacht J. Kanamycin alters cytoplasmic and nuclear phosphoinositide signaling in the organ of Corti in vivo. J Neurochem. 2006;99:269-76 pubmed
    ..b>Kanamycin treatment also disrupts Rac/Rho signaling pathways to the actin cytoskeleton in the mouse inner ear in vivo...
  43. Einsfeldt K, Severo Júnior J, Corrêa Argondizzo A, Medeiros M, Alves T, Almeida R, et al. Cloning and expression of protease ClpP from Streptococcus pneumoniae in Escherichia coli: study of the influence of kanamycin and IPTG concentration on cell growth, recombinant protein production and plasmid stability. Vaccine. 2011;29:7136-43 pubmed publisher
    ..Protein expression was optimized by using central composite design, varying the inducer (IPTG) and kanamycin concentration, with a subsequent analysis being made of the concentration of heterologous protein, cell growth ..
  44. Glueckert R, Bitsche M, Miller J, Zhu Y, Prieskorn D, Altschuler R, et al. Deafferentation-associated changes in afferent and efferent processes in the guinea pig cochlea and afferent regeneration with chronic intrascalar brain-derived neurotrophic factor and acidic fibroblast growth factor. J Comp Neurol. 2008;507:1602-21 pubmed publisher
    ..NTF treatment provided no enhanced maintenance of efferent fibers, although some synaptophysin-positive fibers were detected at atypical sites, suggesting some sprouting of efferent fibers. ..
  45. Khanna A, Raj V, Tarai B, Sood R, Pareek P, Upadhyay D, et al. Emergence and molecular characterization of extensively drug-resistant Mycobacterium tuberculosis clinical isolates from the Delhi Region in India. Antimicrob Agents Chemother. 2010;54:4789-93 pubmed publisher
    ..sequencing the following genes: rpoB (rifampin), katG (isoniazid), gyrA (fluoroquinolones), and rrs (amikacin, kanamycin, and capreomycin)...
  46. Sung W, Lee D. The combination effect of Korean red ginseng saponins with kanamycin and cefotaxime against methicillin-resistant Staphylococcus aureus. Biol Pharm Bull. 2008;31:1614-7 pubmed
    ..To estimate the general combination effects of ginsenosides and commercial antibiotics, such as kanamycin and cefotaxime, on antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA) strains ..
  47. Oliveira P, Prazeres D, Monteiro G. Deletion formation mutations in plasmid expression vectors are unfavored by runaway amplification conditions and differentially selected under kanamycin stress. J Biotechnol. 2009;143:231-8 pubmed publisher
    ..gain some insight into plasmid adaptation and competition by evaluating the impact of distinct concentrations of kanamycin on the differential selection of plasmid recombinant forms: monomer and heterodimers (1+2 and 1+3)...
  48. Jin Y, Jang J, Han C, Lee M. Development of immunoassays for the detection of kanamycin in veterinary fields. J Vet Sci. 2006;7:111-7 pubmed
    Monoclonal antibody against kanamycin was prepared, and competitive direct ELISA and immunochromatographic assay were developed using the antibody to detect kanamycin in animal plasma and milk...
  49. Abrashkin K, Izumikawa M, Miyazawa T, Wang C, Crumling M, Swiderski D, et al. The fate of outer hair cells after acoustic or ototoxic insults. Hear Res. 2006;218:20-9 pubmed
    ..The data show that cochlear supporting cells surround the corpses and/or debris of degenerated outer hair cells, and suggest that outer hair cell remains are phagocytosed by supporting cells within the epithelium. ..
  50. Sugawara I, Zhang J, Li C. Cross-resistance of Mycobacterium tuberculosis isolates among streptomycin, kanamycin and amikacin. Indian J Exp Biol. 2009;47:520-2 pubmed
    ..clinical isolates were subjected to cross-resistance drug testing against two major aminoglycosides, kanamycin (KM) and amikacin (AMK). Among them, 15 clinical isolates (20.3%) were resistant to both KM and AMK...
  51. Xiong H, Chu H, Zhou X, Huang X, Cui Y, Zhou L, et al. Conservation of endocochlear potential in mice with profound hearing loss induced by co-administration of kanamycin and furosemide. Lab Anim. 2011;45:95-102 pubmed publisher
    ..The present study reproduced an adult mouse model of aminoglycoside-induced hearing loss. The mechanism underlying the recovered EP in the model with extensive hair cell death is discussed. ..
  52. Oesterle E, Campbell S, Taylor R, Forge A, Hume C. Sox2 and JAGGED1 expression in normal and drug-damaged adult mouse inner ear. J Assoc Res Otolaryngol. 2008;9:65-89 pubmed
    ..inducing hair cell damage in adult mouse organ of Corti by a single high-dose injection of the aminoglycoside kanamycin followed by a single injection of the loop diuretic furosemide...
  53. Wrześniok D, Otręba M, Beberok A, Buszman E. Impact of kanamycin on melanogenesis and antioxidant enzymes activity in melanocytes--an in vitro study. J Cell Biochem. 2013;114:2746-52 pubmed publisher
    ..This study was undertaken to investigate the effect of aminoglycoside antibiotic-kanamycin on viability, melanogenesis and antioxidant enzymes activity in cultured human normal melanocytes (HEMa-LP)...