Experts and Doctors on humans in Okayama, Japan

Summary

Locale: Okayama, Japan
Topic: humans

Top Publications

  1. Yokota O, Terada S, Ishizu H, Tsuchiya K, Kitamura Y, Ikeda K, et al. NACP/alpha-synuclein immunoreactivity in diffuse neurofibrillary tangles with calcification (DNTC). Acta Neuropathol. 2002;104:333-41 pubmed
  2. Akagi S, Ichikawa H, Okada T, Sarai A, Sugimoto T, Morimoto H, et al. The critical role of SRC homology domain 2-containing tyrosine phosphatase-1 in recombinant human erythropoietin hyporesponsive anemia in chronic hemodialysis patients. J Am Soc Nephrol. 2004;15:3215-24 pubmed
  3. Suzuki M, Shiraha H, Fujikawa T, Takaoka N, Ueda N, Nakanishi Y, et al. Des-gamma-carboxy prothrombin is a potential autologous growth factor for hepatocellular carcinoma. J Biol Chem. 2005;280:6409-15 pubmed
    ..Based on these results, we believe that DCP acts as an autologous mitogen for HCC cell lines. The Met-Janus kinase 1-STAT3 signaling pathway may be a major signaling pathway for DCP-induced cell proliferation. ..
  4. Kudo T, Sutou S. Usage of putative chicken U6 promoters for vector-based RNA interference. J Reprod Dev. 2005;51:411-7 pubmed
    ..The promoter activity was not as strong as that of a commercially available siRNA expression vector. This probably reflects artificial sequences between the promoters and synthetic DNA encoding shRNA. ..
  5. Takigawa N, Takeuchi M, Shibayama T, Yoshida I, Kawata N, Tada A, et al. Successful treatment of a patient with synchronous advanced non-small cell lung cancer and acute myeloid leukemia by a combination of gefitinib, low-dose cytarabine and aclarubicin. Anticancer Res. 2005;25:2579-82 pubmed
    ..This combination could be safely administered in the elderly patient with poor performance status and was effective for both lung cancer and acute myeloid leukemia. ..
  6. Kugo A, Terada S, Ata T, Ido Y, Kado Y, Ishihara T, et al. Japanese version of the Frontal Assessment Battery for dementia. Psychiatry Res. 2007;153:69-75 pubmed
    ..972), test-retest reliability (r=0.769), and internal consistency (Cronbach's coefficient alpha=0.715). The FAB is a valid and reliable screening test to evaluate cognitive dysfunction among patients with dementia. ..
  7. Akhter R, Hassan N, Aida J, Takinami S, Morita M. Relationship between betel quid additives and established periodontitis among Bangladeshi subjects. J Clin Periodontol. 2008;35:9-15 pubmed
    ..The results indicate that betel quid additives might significantly enhance periodontitis in the population studied. ..
  8. Ennishi D, Terui Y, Yokoyama M, Mishima Y, Takahashi S, Takeuchi K, et al. Increased incidence of interstitial pneumonia by CHOP combined with rituximab. Int J Hematol. 2008;87:393-397 pubmed publisher
    ..jirovecii and fungal infection. The need for prophylactic antifungals and ST during R-CHOP should be evaluated by randomized controlled trials. ..
  9. Kawasaki K, Watanabe M, Sakaguchi M, Ogasawara Y, Ochiai K, Nasu Y, et al. REIC/Dkk-3 overexpression downregulates P-glycoprotein in multidrug-resistant MCF7/ADR cells and induces apoptosis in breast cancer. Cancer Gene Ther. 2009;16:65-72 pubmed publisher
    ..We suggest that REIC/Dkk-3 is a novel target for breast cancer treatment and that Ad-REIC might be an attractive agent against drug-resistant cancer in combination with conventional antineoplastic agents. ..

More Information

Publications525 found, 100 shown here

  1. Segawa Y, Kiura K, Takigawa N, Kamei H, Harita S, Hiraki S, et al. Phase III trial comparing docetaxel and cisplatin combination chemotherapy with mitomycin, vindesine, and cisplatin combination chemotherapy with concurrent thoracic radiotherapy in locally advanced non-small-cell lung cancer: OLCSG 0007. J Clin Oncol. 2010;28:3299-306 pubmed publisher
    ..056). DP chemotherapy combined with concurrent TRT is an alternative to MVP chemotherapy for patients with LA-NSCLC. ..
  2. Koreishi M, Gniadek T, Yu S, Masuda J, Honjo Y, Satoh A. The golgin tether giantin regulates the secretory pathway by controlling stack organization within Golgi apparatus. PLoS ONE. 2013;8:e59821 pubmed publisher
    ..These results suggest that the spatial organization of the Golgi ribbon is mediated by giantin, which also plays a role in cargo transport and sugar modifications...
  3. Dote H, Toyooka S, Tsukuda K, Yano M, Ouchida M, Doihara H, et al. Aberrant promoter methylation in human DAB2 interactive protein (hDAB2IP) gene in breast cancer. Clin Cancer Res. 2004;10:2082-9 pubmed
    ..Our results demonstrate that hDAB2IP methylation frequently is present in breast cancer and plays a key role in hDAB2IP inactivation, suggesting the relationship between hDAB2IP methylation and lymph node metastasis of breast cancer. ..
  4. Mineshiba J, Myokai F, Mineshiba F, Matsuura K, Nishimura F, Takashiba S. Transcriptional regulation of beta-defensin-2 by lipopolysaccharide in cultured human cervical carcinoma (HeLa) cells. FEMS Immunol Med Microbiol. 2005;45:37-44 pubmed
    ..Our results suggest that the two NF-(kappa)B binding sites contribute to LPS-mediated hBD-2 transcription while the NF-IL6 binding site represses LPS-independent hBD-2 transcription in the HeLa cells. ..
  5. Honjo O, Ishino K, Kawada M, Ohtsuki S, Akagi T, Sano S. Late outcome after repair of aortico-left ventricular tunnel: 10-year follow-up. Circ J. 2006;70:939-41 pubmed
    ..Careful long-term follow-up is necessary because patients with ALVT have some inherent structural abnormalities from the left ventricular outflow tract to the aortic root. ..
  6. Kobayashi K, Jacobs J, Gotman J. Detection of changes of high-frequency activity by statistical time-frequency analysis in epileptic spikes. Clin Neurophysiol. 2009;120:1070-7 pubmed publisher
    ..We developed a promising tool to study the HFOs that may be closely linked to the pathophysiology of epileptogenesis. ..
  7. Fujimura A, Michiue H, Nishiki T, Ohmori I, Wei F, Matsui H, et al. Expression of a constitutively active calcineurin encoded by an intron-retaining mRNA in follicular keratinocytes. PLoS ONE. 2011;6:e17685 pubmed publisher
    ..We therefore suggest that the calcineurin/NFAT pathway has a unique regulatory role in hair follicle development. ..
  8. Yamaji H, Murakami T, Hina K, Higashiya S, Kawamura H, Murakami M, et al. Usefulness of dabigatran etexilate as periprocedural anticoagulation therapy for atrial fibrillation ablation. Clin Drug Investig. 2013;33:409-18 pubmed publisher
    ..Dabigatran etexilate is an effective and safe anticoagulation therapy for AF ablation. Thus, dabigatran etexilate appears to be useful as an alternative anticoagulant therapy to warfarin for AF ablation. ..
  9. Mizoo T, Taira N, Nishiyama K, Nogami T, Iwamoto T, Motoki T, et al. Effects of lifestyle and single nucleotide polymorphisms on breast cancer risk: a case-control study in Japanese women. BMC Cancer. 2013;13:565 pubmed publisher
    ..In Japanese women, rs2046210 and 3757318 located near the ESR1 gene are associated with a risk of breast cancer, as in other Asian women. However, our findings suggest that exercise can decrease this risk in allele carriers. ..
  10. Hayata K, Hiramatsu Y, Masuyama H, Eto E, Mitsui T, Tamada S. Discrepancy between Non-invasive Prenatal Genetic Testing (NIPT) and Amniotic Chromosomal Test due to Placental Mosaicism: A Case Report and Literature Review. Acta Med Okayama. 2017;71:181-185 pubmed publisher
    ..Of the 18,251 cases undergoing NIPT in the past 2 years in Japan, 51 had indeterminate results; this was the second case in which a subsequent re-examination gave a positive result for trisomy 18. ..
  11. Okada S, Wada J, Tsukinoki T, Hirano N, Watanabe Y, Shikata K, et al. Angiocentric immunoproliferative lesions of the lung associated with diffuse renal involvement. Am J Kidney Dis. 2002;39:E12 pubmed
    ..We recommend the imaging of kidneys for diagnosis and following renal biopsy to evaluate the renal involvement of angiocentric immunoproliferative lesions...
  12. Sezaki N, Ishimaru F, Takata M, Tabayashi T, Nakase K, Kozuka T, et al. Over-expression of the dominant-negative isoform of Ikaros confers resistance to dexamethasone-induced and anti-IgM-induced apoptosis. Br J Haematol. 2003;121:165-9 pubmed
    ..Further investigations of the mechanism of leukaemogenesis associated with the over-expression of Ik-6 are warranted. ..
  13. Mishima K, Yamada T, Ohura A, Sugahara T. Production of a range image for facial motion analysis: a method for analyzing lip motion. Comput Med Imaging Graph. 2006;30:53-9 pubmed
    ..The lip motions of six healthy adults during phonation was analyzed. ..
  14. Omote H, Hiasa M, Matsumoto T, Otsuka M, Moriyama Y. The MATE proteins as fundamental transporters of metabolic and xenobiotic organic cations. Trends Pharmacol Sci. 2006;27:587-93 pubmed
    ..Thus, we propose that members of the MATE family are organic cation exporters that excrete metabolic or xenobiotic organic cations from the body. ..
  15. Miyake Y, Iwasaki Y, Ishikawa S, Tatsukawa M, Nawa T, Kato J, et al. A homosexual Japanese man with acute hepatitis due to hepatitis B virus genotype ae, concurrent with amebic colitis. Acta Med Okayama. 2007;61:35-9 pubmed
    ..Furthermore, education of homosexual men regarding hepatitis B virus, hepatitis B virus vaccination, and amebiasis is urgently required...
  16. Shiotani A, Uedo N, Iishi H, Tatsuta M, Ishiguro S, Nakae Y, et al. Re-expression of sonic hedgehog and reduction of CDX2 after Helicobacter pylori eradication prior to incomplete intestinal metaplasia. Int J Cancer. 2007;121:1182-9 pubmed
    ..Pepsinogen I may be a useful marker in patients with a residual higher risk of gastric cancer after H. pylori eradication. ..
  17. Kobara K, Eguchi A, Watanabe S, Shinkoda K. The influence of the distance between the backrest of a chair and the position of the pelvis on the maximum pressure on the ischium and estimated shear force. Disabil Rehabil Assist Technol. 2008;3:285-91 pubmed publisher
    ..The purpose of this study was to investigate the relation between the backrest of a chair and the position of the pelvis on the maximum pressure at the ischium and the estimated shear force encountered while sitting in a chair...
  18. Nakamura K, Takamoto N, Abarzua F, Hongo A, Kodama J, Nasu Y, et al. Hepsin inhibits the cell growth of endometrial cancer. Int J Mol Med. 2008;22:389-97 pubmed
  19. Okimoto N, Hayashi T, Ishiga M, Nanba F, Kishimoto M, Yagi S, et al. Clinical features of Escherichia coli pneumonia. J Infect Chemother. 2010;16:216-8 pubmed publisher
    ..coli; (3) previous administration of antibacterial agents did not become a risk factor; (4) resistance to ampicillin (ABPC) and levofloxacin (LVFX) was observed; and (5) mortality was 22.7%. ..
  20. Soto Gutierrez A, Navarro Alvarez N, Yagi H, Nahmias Y, Yarmush M, Kobayashi N. Engineering of an hepatic organoid to develop liver assist devices. Cell Transplant. 2010;19:815-22 pubmed publisher
    ..The novelty of the culture's sinusoid-like organization and function strongly support the integration of liver nonparenchymal units into hepatocyte coculture-based LADs as a potential destination therapy for liver failure...
  21. Ishizaki Y, Watabe S, Mimaki N, Arakaki Y, Ohtsuka Y. [Paroxysmal automatic movements mimicking neonatal seizures induced by midazolam]. No To Hattatsu. 2011;43:291-4 pubmed
    ..Since midazolam is frequently used in neonates for sedation during various examinations, future investigations on the selection of appropriate drugs and dosage for sedation in neonates, including the usage of midazolam, are necessary. ..
  22. Sato Y, Inoue D, Asano N, Takata K, Asaoku H, Maeda Y, et al. Association between IgG4-related disease and progressively transformed germinal centers of lymph nodes. Mod Pathol. 2012;25:956-67 pubmed publisher
    ..Nine patients were administered steroid therapy when the lesions progressed, to which all responded well. We suggest that IgG4(+) progressively transformed germinal centers should be included in the IgG4-related disease spectrum. ..
  23. Ito M, Shien T, Kaji M, Mizoo T, Iwamoto T, Nogami T, et al. Correlation between 18F-fluorodeoxyglucose Positron Emission Tomography/computed Tomography and Clinicopathological Features in Invasive Ductal Carcinoma of the Breast. Acta Med Okayama. 2015;69:333-8 pubmed
    ..The determination of the preoperative SUVmax might help classify Luminal A and Luminal B patients among luminal-type breast cancer patients. ..
  24. Masuyama H, Hiramatsu Y. Involvement of suppressor for Gal 1 in the ubiquitin/proteasome-mediated degradation of estrogen receptors. J Biol Chem. 2004;279:12020-6 pubmed
    ..Moreover, BSA strongly blocked the ubiquitination and degradation of ERbeta compared with estradiol, suggesting that BSA may affect the ERbeta-mediated transcription of target genes by inhibiting ERbeta degradation. ..
  25. Miwa Y, Mitsuzumi H, Yamada M, Arai N, Tanabe F, Okada K, et al. Suppression of apolipoprotein B secretion from HepG2 cells by glucosyl hesperidin. J Nutr Sci Vitaminol (Tokyo). 2006;52:223-31 pubmed
    ..This effect is speculated to be associated with the improvement of VLDL metabolic abnormality in hypertriglyceridemic subjects and considered as a mechanism of lowering serum TG. ..
  26. Kamiya K, Aoyama Y, Yamaguchi M, Ukida A, Mizuno Ikeda K, Fujii K, et al. Clues to diagnosis for unusual mucosal pemphigus demonstrating undetectable anti-desmoglein 3 serum antibodies by routine tests. J Dermatol. 2015;42:572-9 pubmed publisher
    ..In conclusion, the detection of morphological changes in Dsg3 distribution and highly sensitive ELISA method could be useful for the early diagnosis of PV recurrence. ..
  27. Frauscher B, Bartolomei F, Kobayashi K, Cimbalnik J, van t Klooster M, Rampp S, et al. High-frequency oscillations: The state of clinical research. Epilepsia. 2017;58:1316-1329 pubmed publisher
    ..Prospective multicenter trials are awaited to gather information over long recording periods in large patient samples. ..
  28. Kaizu Y, Nakao S, Yoshida S, Hayami T, Arima M, Yamaguchi M, et al. Optical Coherence Tomography Angiography Reveals Spatial Bias of Macular Capillary Dropout in Diabetic Retinopathy. Invest Ophthalmol Vis Sci. 2017;58:4889-4897 pubmed publisher
    ..Our purpose is to evaluate the spatial bias of macular capillary dropout accompanying diabetic retinopathy (DR) using optical coherence tomography angiography (OCTA)...
  29. Obata K, Shimo T, Okui T, Matsumoto K, Takada H, Takabatake K, et al. Role of Neurokinin 3 Receptor Signaling in Oral Squamous Cell Carcinoma. Anticancer Res. 2017;37:6119-6123 pubmed
    ..The neurokinin 3 receptor (NK-3R) is differentially expressed in the central nervous system including cases of human oral squamous cell carcinoma. However, the role of NK-3R signaling in oral squamous cell carcinoma is not well known...
  30. Imai K, Sarker A, Akiyama K, Ikeda S, Yao M, Tsutsui K, et al. Genomic structure and sequence of a human homologue (NTHL1/NTH1) of Escherichia coli endonuclease III with those of the adjacent parts of TSC2 and SLC9A3R2 genes. Gene. 1998;222:287-95 pubmed
    ..This paper demonstrates for the first time the spatial relationship of these three genes (TSC2, NTHL1 and SLC9A3R2) at the nucleotide level, and the presence of multiple transcription initiation sites of the NTHL1 and TSC2 genes. ..
  31. Uchida A, Hirano S, Kitao H, Ogino A, Rai K, Toyooka S, et al. Activation of downstream epidermal growth factor receptor (EGFR) signaling provides gefitinib-resistance in cells carrying EGFR mutation. Cancer Sci. 2007;98:357-63 pubmed
  32. Inoue K, Rogers J. Botulinum toxin injection into Riolan's muscle: somatosensory 'trick'. Eur Neurol. 2007;58:138-41 pubmed
    ..The proposed mechanism is not that of muscle relaxation but rather modulation of the somatosensory cortex, similar to that of a 'sensory trick' in patients with dystonia. ..
  33. Inutsuka M, Ohta H, Ogawa K, Yoshinaga H, Ohtsuka Y. [Case of Sturge-Weber syndrome manifesting complex partial status epilepticus]. No To Hattatsu. 2009;41:52-6 pubmed
    ..CPSE should be recognized as one of the seizure types of SWS. ..
  34. Nakamura K, Abarzua F, Hongo A, Kodama J, Nasu Y, Kumon H, et al. The role of hepatocyte growth factor activator inhibitor-1 (HAI-1) as a prognostic indicator in cervical cancer. Int J Oncol. 2009;35:239-48 pubmed
    ..022 and p=0.011, respectively). The present study proposes that these findings may be considered HAI-1 as a therapeutic target for treatment and identify as a favorable prognostic marker for cancer patients of cervical cancer. ..
  35. Furuta M, Ekuni D, Yamamoto T, Irie K, Koyama R, Sanbe T, et al. Relationship between periodontitis and hepatic abnormalities in young adults. Acta Odontol Scand. 2010;68:27-33 pubmed publisher
    ..Elevated ALT could be a potential risk indicator for periodontitis among young males. Monitoring hepatic abnormalities to prevent periodontitis must be better understood, even in the young adult population. ..
  36. Yasui K, Yashiro M, Tsuge M, Manki A, Takemoto K, Yamamoto M, et al. Thalidomide dramatically improves the symptoms of early-onset sarcoidosis/Blau syndrome: its possible action and mechanism. Arthritis Rheum. 2010;62:250-7 pubmed publisher
    ..Inhibition of IKK might be a pharmacologic action by which thalidomide down-regulates NF-kappaB signaling. Thalidomide may be an effective medication in patients with severe complications of EOS, including ocular involvement. ..
  37. Zhang K, Watanabe M, Kashiwakura Y, Li S, Edamura K, Huang P, et al. Expression pattern of REIC/Dkk-3 in various cell types and the implications of the soluble form in prostatic acinar development. Int J Oncol. 2010;37:1495-501 pubmed
    ..Current results suggest that REIC/Dkk-3 may play a role in regulating the morphological process of normal tissue architecture through an autocrine and/or paracrine manner. ..
  38. Kuroda S, Fujiwara T, Shirakawa Y, Yamasaki Y, Yano S, Uno F, et al. Telomerase-dependent oncolytic adenovirus sensitizes human cancer cells to ionizing radiation via inhibition of DNA repair machinery. Cancer Res. 2010;70:9339-48 pubmed publisher
    ..These results illustrate the potential of combining oncolytic virotherapy and ionizing radiation as a promising strategy in the management of human cancer. ..
  39. Miyashita N, Kawai Y, Yamaguchi T, Ouchi K. Evaluation of serological tests for diagnosis of Bordetella pertussis infection in adolescents and adults. Respirology. 2011;16:1189-95 pubmed publisher
    ..To determine the serological criteria, the comparative titres of bacterial agglutination antibody and anti-pertussis toxin (PT) antibody were evaluated...
  40. Honami T, Shimo T, Okui T, Kurio N, Hassan N, Iwamoto M, et al. Sonic hedgehog signaling promotes growth of oral squamous cell carcinoma cells associated with bone destruction. Oral Oncol. 2012;48:49-55 pubmed publisher
    ..These findings suggest that Shh signaling is a potential target for the treatment of oral squamous cell carcinoma associated with bone destruction. ..
  41. Katase N, Lefeuvre M, Tsujigiwa H, Fujii M, Ito S, Tamamura R, et al. Knockdown of Dkk-3 decreases cancer cell migration and invasion independently of the Wnt pathways in oral squamous cell carcinoma?derived cells. Oncol Rep. 2013;29:1349-55 pubmed publisher
    ..These data demonstrated that Dkk-3 expression in OSCC was different than that in adenocarcinomas. Dkk-3 may possess an oncogenic function that is independent of Wnt signaling. ..
  42. Hayashi S, Terada S, Nagao S, Ikeda C, Shindo A, Oshima E, et al. Burden of caregivers for patients with mild cognitive impairment in Japan. Int Psychogeriatr. 2013;25:1357-63 pubmed publisher
    ..001) and memory problems (p = 0.022) of the patient. The caregiver burden of MCI patients should be given more attention. The management of neurobehavioral symptoms may be important to reduce the burden on caregivers of MCI patients. ..
  43. Ishiyama H, Satoh T, Yorozu A, Saito S, Kataoka M, Hashine K, et al. Multi-institutional retrospective analysis of learning curves on dosimetry and operation time before and after introduction of intraoperatively built custom-linked seeds in prostate brachytherapy. J Radiat Res. 2016;57:68-74 pubmed publisher
    ..Our study revealed no dosimetric demerits, no learning curve for dosimetry, and a slightly extended operation time for IBCL seeds. A significant reduction in the rate of seed migration was identified in the IBCL-seed group. ..
  44. Nagano T, Wu W, Tsumura K, Yonemoto Yano H, Kamada T, Haruma K. The inhibitory effect of soybean and soybean isoflavone diets on 2,4-dinitrofluorobenzene-induced contact hypersensitivity in mice. Biosci Biotechnol Biochem. 2016;80:991-7 pubmed publisher
    ..These results suggest that soybean and SI consumption downregulated the gene and protein expression of CCL24, thereby affording protection against CHS in mice. ..
  45. Obata K, Shimo T, Okui T, Matsumoto K, Takada H, Takabatake K, et al. Tachykinin Receptor 3 Distribution in Human Oral Squamous Cell Carcinoma. Anticancer Res. 2016;36:6335-6341 pubmed
    ..5-positive sensory nerves in the mandible. Our results suggest that peripheral sensory nerve-derived TAC3 may affect gingival oral squamous cell carcinoma cells through TACR3 in the bone matrix. ..
  46. Kawano M, Saeki T, Nakashima H, Nishi S, Yamaguchi Y, Hisano S, et al. Proposal for diagnostic criteria for IgG4-related kidney disease. Clin Exp Nephrol. 2011;15:615-626 pubmed publisher
    ..The provisional criteria and algorithm appear to be useful for clarifying the entity of IgG4-RKD and seeking underlying IgG4-RKD cases; however, further experience is needed to confirm the validity of these criteria. ..
  47. Araki M, Saika T, Araki D, Kobayashi Y, Uehara S, Watanabe T, et al. Laparoscopic management of complicated urachal remnants in adults. World J Urol. 2012;30:647-50 pubmed
    ..13 days) due to a minimum degree of dysuria. A laparoscopic approach with the removal of urachal remnants via the umbilicus appears to be a safe and effective alternative with better cosmesis when compared to an open approach. ..
  48. Mizutani S, Ekuni D, Furuta M, Tomofuji T, Irie K, Azuma T, et al. Effects of self-efficacy on oral health behaviours and gingival health in university students aged 18- or 19-years-old. J Clin Periodontol. 2012;39:844-9 pubmed publisher
    ..Improving self-efficacy may be beneficial for maintaining good gingival health in university students. To prevent gingivitis, the approach of enhancing self-efficacy in university students would be useful. ..
  49. Koreishi M, Yu S, Oda M, Honjo Y, Satoh A. CK2 phosphorylates Sec31 and regulates ER-To-Golgi trafficking. PLoS ONE. 2013;8:e54382 pubmed publisher
    ..These results suggest that Sec31 phosphorylation by CK2 controls the duration of COPII vesicle formation, which regulates ER-to-Golgi trafficking...
  50. Yamaguchi K, Takeuchi K. Consumer preferences for reduced packaging under economic instruments and recycling policy. Waste Manag. 2016;48:540-547 pubmed publisher
    ..However, unit-based pricing combined with plastic separation for recycling reduces WTP. This result suggests that recycling policy weakens the effect of economic instruments on source reduction of waste. ..
  51. Yamaguchi T, Morita T, Nitto A, Takahashi N, Miyamoto S, Nishie H, et al. Establishing Cutoff Points for Defining Symptom Severity Using the Edmonton Symptom Assessment System-Revised Japanese Version. J Pain Symptom Manage. 2016;51:292-7 pubmed publisher
    ..The cutoff points established for determining the level of symptom severity using ESAS-r provides a guide for symptom management in Japanese cancer patients. ..
  52. Noguchi H, Kondo H, Kondo M, Shiraiwa M, Monobe Y. Inflammatory pseudotumor of the spleen: a case report. Jpn J Clin Oncol. 2000;30:196-203 pubmed
    ..The patient is currently alive and asymptomatic, 24 months after surgery. Inflammatory pseudotumors of the spleen are extremely rare and only 39 cases have been reported in the medical literature. ..
  53. Kondo S, Kubota S, Shimo T, Nishida T, Yosimichi G, Eguchi T, et al. Connective tissue growth factor increased by hypoxia may initiate angiogenesis in collaboration with matrix metalloproteinases. Carcinogenesis. 2002;23:769-76 pubmed
    ..This cascade may play critical roles in the hypoxia-induced neovascularization that accompanies tumor invasion in vivo. ..
  54. Okimoto N, Asaoka N, Osaki K, Kurihara T, Yamato K, Sunagawa T, et al. Clinical features of Q fever pneumonia. Respirology. 2004;9:278-82 pubmed
  55. Takigawa T, Horike T, Ohashi Y, Kataoka H, Wang D, Kira S. Were volatile organic compounds the inducing factors for subjective symptoms of employees working in newly constructed hospitals?. Environ Toxicol. 2004;19:280-90 pubmed
  56. Mino N, Naomoto Y, Shirakawa Y, Matsuoka J, Nobuhisa T, Gunduz M, et al. Stable long-term induction of perforin-positive CD8+ T cells in gut by oral administration of streptococcal preparation OK-432. Int J Mol Med. 2004;14:801-6 pubmed
    ..The results suggest that CD8(+) cells in lamina propria mucosa play a significant role as effectors in the mucosal immune system which is activated by various stimuli. ..
  57. Otsuka F, Miyoshi T, Murakami K, Inagaki K, Takeda M, Ujike K, et al. An extra-adrenal abdominal pheochromocytoma causing ectopic ACTH syndrome. Am J Hypertens. 2005;18:1364-8 pubmed
    ..This is the first report of ectopic ACTH syndrome induced by an extra-adrenal abdominal paraganglioma...
  58. Kinomura M, Maeshima Y, Kodera R, Morinaga H, Saito D, Nakao K, et al. A case of immunotactoid glomerulopathy exhibiting nephrotic syndrome successfully treated with corticosteroids and antihypertensive therapy. Clin Exp Nephrol. 2009;13:378-384 pubmed publisher
    ..This case demonstrates that accurate diagnosis of ITG may result in successful therapeutic outcome. ..
  59. Masuyama H, Tateishi Y, Matsuda M, Hiramatrsu Y. Hyperreactio luteinalis with both markedly elevated human chorionic gonadotropin levels and an imbalance of angiogenic factors subsequently developed severe early-onset preeclampsia. Fertil Steril. 2009;92:393.e1-3 pubmed publisher
    ..Although HL complicated with PE is very rare, our case suggests that HL associated with both an elevated hCG level and an imbalance of angiogenic factors might be a risk/predictive factor for severe, early onset PE. ..
  60. Kamo N, Naomoto Y, Shirakawa Y, Yamatsuji T, Hirota S, Fujiwara Y, et al. Involvement of focal adhesion kinase in the progression and prognosis of gastrointestinal stromal tumors. Hum Pathol. 2009;40:1643-9 pubmed publisher
  61. Imai Y, Yoshinaga H, Ishizaki Y, Watanabe Y, Ohtsuka Y. [Reappraisal of vitamin B6 therapy for West syndrome]. No To Hattatsu. 2009;41:457-61 pubmed
    ..However, we suspect there might be many cases in which the efficacy of VB6 therapy has not been properly assessed due to the short observation period and/or side effects. ..
  62. Hiraki T, Gobara H, Mimura H, Sano Y, Toyooka S, Shibamoto K, et al. Brachial nerve injury caused by percutaneous radiofrequency ablation of apical lung cancer: a report of four cases. J Vasc Interv Radiol. 2010;21:1129-33 pubmed publisher
    ..These symptoms partially receded over time. The indications of RF ablation in patients with apical lung cancer should be carefully determined because of the risk of brachial nerve injury associated with the procedure. ..
  63. Mesaki K, Tanabe K, Obayashi M, Oe N, Takei K. Fission of tubular endosomes triggers endosomal acidification and movement. PLoS ONE. 2011;6:e19764 pubmed publisher
    ..These results demonstrate that the fission of recycling tubules is the first important step in endosomal maturation and degradation in the lysosome. We believe this to be the first evidence of a cascade from sorting to degradation. ..
  64. Kubo T, Takigawa N, Osawa M, Harada D, Ninomiya T, Ochi N, et al. Subpopulation of small-cell lung cancer cells expressing CD133 and CD87 show resistance to chemotherapy. Cancer Sci. 2013;104:78-84 pubmed publisher
    ..By contrast, CD133-/CD87- cells showed the highest tumorigenic potential. In conclusion, both CD133 and CD87 proved to be inadequate markers for CSCs; however, they might be beneficial for predicting resistance to chemotherapy. ..
  65. Maki Y, Soh J, Ichimura K, Shien K, Furukawa M, Muraoka T, et al. Impact of GLUT1 and Ki-67 expression on early?stage lung adenocarcinoma diagnosed according to a new international multidisciplinary classification. Oncol Rep. 2013;29:133-40 pubmed publisher
    ..Our results strongly suggest that GLUT1 and Ki-67 play important roles in acquiring biological malignant potential in early-stage lung adenocarcinoma. ..
  66. Kawakami I, Kobayashi Z, Arai T, Yokota O, Nonaka T, Aoki N, et al. Chorea as a clinical feature of the basophilic inclusion body disease subtype of fused-in-sarcoma-associated frontotemporal lobar degeneration. Acta Neuropathol Commun. 2016;4:36 pubmed publisher
    ..Thus, our findings suggest that the clinical feature of choreoathetosis in bvFTD might be associated with FTLD-FUS, and in particular, with the BIBD subtype. ..
  67. Soga Y, Nishimura F, Ohtsuka Y, Araki H, Iwamoto Y, Naruishi H, et al. CYP2C polymorphisms, phenytoin metabolism and gingival overgrowth in epileptic subjects. Life Sci. 2004;74:827-34 pubmed
  68. Kubota S, Kawata K, Yanagita T, Doi H, Kitoh T, Takigawa M. Abundant retention and release of connective tissue growth factor (CTGF/CCN2) by platelets. J Biochem. 2004;136:279-82 pubmed
    ..Considering that CTGF/CCN2 promotes angiogenesis, cartilage regeneration, fibrosis and platelet adhesion, it may be now regarded as one of the major functional components of platelets. ..
  69. Hashimoto I, Wada J, Hida A, Baba M, Miyatake N, Eguchi J, et al. Elevated serum monocyte chemoattractant protein-4 and chronic inflammation in overweight subjects. Obesity (Silver Spring). 2006;14:799-811 pubmed
    ..These chemokines, especially MCP-4, may be critical molecules that link obesity and chronic inflammation. ..
  70. Kaji S, Murayama K, Nagata I, Nagasaka H, Takayanagi M, Ohtake A, et al. Fluctuating liver functions in siblings with MPV17 mutations and possible improvement associated with dietary and pharmaceutical treatments targeting respiratory chain complex II. Mol Genet Metab. 2009;97:292-6 pubmed publisher
  71. Sato Y, Kojima M, Takata K, Huang X, Hayashi E, Manabe A, et al. Immunoglobulin G4-related lymphadenopathy with inflammatory pseudotumor-like features. Med Mol Morphol. 2011;44:179-82 pubmed publisher
    ..1%. These findings were consistent with IgG4-related lymphadenopathy. In conclusion, pathologists should consider IgG4-related lymphadenopathy when diagnosing a lesion with IPT-like features. ..
  72. Watanabe M, Arita S, Hashizume H, Honda M, Nishida K, Ozaki T. Multiple regression analysis for grading and prognosis of cubital tunnel syndrome: assessment of Akahori's classification. Acta Med Okayama. 2013;67:35-44 pubmed
    ..It is reliable, reproducible and well-correlated with the postoperative prognosis. In addition, the established prediction formula is useful to reduce the diagnostic complexity of Akahori's classification...
  73. Effendi N, Ogawa K, Mishiro K, Takarada T, Yamada D, Kitamura Y, et al. Synthesis and evaluation of radioiodinated 1-{2-[5-(2-methoxyethoxy)-1H-benzo[d]imidazol-1-yl]quinolin-8-yl}piperidin-4-amine derivatives for platelet-derived growth factor receptor ? (PDGFR?) imaging. Bioorg Med Chem. 2017;25:5576-5585 pubmed publisher
    ..However, further modification of its structure will be required to obtain a more appropriate PDGFR?-targeted imaging agent with a higher signal/noise ratio. ..
  74. Gochi A, Orita K, Fuchimoto S, Tanaka N, Ogawa N. The prognostic advantage of preoperative intratumoral injection of OK-432 for gastric cancer patients. Br J Cancer. 2001;84:443-51 pubmed
    ..Preoperative intratumoral injection of OK-432 is technically very easy and has no serious adverse effects, so it is a promising form of neoadjuvant immunotherapy for advanced gastric cancer. ..
  75. Kiso T, Mizuno M, Nasu J, Shimo K, Uesu T, Yamamoto K, et al. Enhanced expression of decay-accelerating factor and CD59/homologous restriction factor 20 in intestinal metaplasia, gastric adenomas and intestinal-type gastric carcinomas but not in diffuse-type carcinomas. Histopathology. 2002;40:339-47 pubmed
  76. Matsuo Y, Drexler H, Takeuchi M, Tanaka M, Orita K. Establishment of the T-cell large granular lymphocyte leukemia cell line MOTN-1 carrying natural killer-cell antigens. Leuk Res. 2002;26:873-9 pubmed
    ..The scientific significance of MOTN-1 lies in (1) the rarity of this type of leukemia cell lines, (2) the co-expression of various T- and natural killer (NK)-cell-associated markers, and (3) its unique chromosomal aberrations. ..
  77. Jo Y, Hiratsuka J, Fujii T, Takenaka A, Fujisawa M. High-dose-rate iridium-192 afterloading therapy combined with external beam radiotherapy for T1c-T3bN0M0 prostate cancer. Urology. 2004;64:556-60 pubmed
    ..Additional long-term follow-up is needed to confirm this treatment. ..
  78. Yamamoto H, Hanafusa H, Ouchida M, Yano M, Suzuki H, Murakami M, et al. Single nucleotide polymorphisms in the EXO1 gene and risk of colorectal cancer in a Japanese population. Carcinogenesis. 2005;26:411-6 pubmed
    ..This is the first report to provide evidence for an association of EXO1 gene polymorphisms with colorectal cancer risk. The EXO1 genotypes were not associated with any clinicopathological characteristics in colorectal cancer patients. ..
  79. Jin G, Kondo E, Miyake T, Shibata M, Takashima T, Liu Y, et al. Expression and intracellular localization of FKHRL1 in mammary gland neoplasms. Acta Med Okayama. 2004;58:197-205 pubmed
    ..0001). Thus, the activation of FKHRL1 seems to be recognized as one of the specific features of invasive ductal carcinoma of the breast. ..
  80. Ueki A, Isozaki Y, Kusaka M. Anti-caspase-8 autoantibody response in silicosis patients is associated with HLA-DRB1, DQB1 and DPB1 alleles. J Occup Health. 2005;47:61-7 pubmed
    ..Repeated and continuous screening of autoantibodies seems to be necessary among workers in contact with Si-related substances for the detection of immunological disorders in the early stage. ..
  81. Morizane S, Suzuki D, Tsuji K, Oono T, Iwatsuki K. The role of CD4 and CD8 cytotoxic T lymphocytes in the formation of viral vesicles. Br J Dermatol. 2005;153:981-6 pubmed
    ..Herpetic vesicles caused by herpes simplex virus and varicella zoster virus, and hydroa vacciniforme (HV) are characterized by umbilicated vesicule formation...
  82. Hiraki T, Yasui K, Mimura H, Gobara H, Mukai T, Hase S, et al. Radiofrequency ablation of metastatic mediastinal lymph nodes during cooling and temperature monitoring of the tracheal mucosa to prevent thermal tracheal damage: initial experience. Radiology. 2005;237:1068-74 pubmed
    ..Radiofrequency ablation may be effective for local control of small metastatic mediastinal lymph nodes, and cooling and temperature monitoring of the tracheal mucosa in the proper position may prevent thermal tracheal damage. ..
  83. Tabayashi T, Ishimaru F, Takata M, Kataoka I, Nakase K, Kozuka T, et al. Characterization of the short isoform of Helios overexpressed in patients with T-cell malignancies. Cancer Sci. 2007;98:182-8 pubmed
    ..Our results suggest a critical role for Helios in the mechanism of leukemogenesis. ..
  84. Sutou S, Kunishi M, Kudo T, Wongsrikeao P, Miyagishi M, Otoi T. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology. BMC Biotechnol. 2007;7:44 pubmed
    ..The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo. ..
  85. Miyashita N, Obase Y, Ouchi K, Kawasaki K, Kawai Y, Kobashi Y, et al. Clinical features of severe Mycoplasma pneumoniae pneumonia in adults admitted to an intensive care unit. J Med Microbiol. 2007;56:1625-9 pubmed
    ..The delayed administration of adequate antibiotics may contribute to the severity of M. pneumoniae pneumonia. Early corticosteroid therapy with adequate antibiotics should be considered...
  86. Inoue T, Kobayashi K, Oka M, Yoshinaga H, Ohtsuka Y. Spectral characteristics of EEG gamma rhythms associated with epileptic spasms. Brain Dev. 2008;30:321-8 pubmed
    ..An analysis of the ictal gamma rhythms might give some insight into the generative mechanism of spasms. ..
  87. Sakamaki H, Ishizawa K, Taniwaki M, Fujisawa S, Morishima Y, Tobinai K, et al. Phase 1/2 clinical study of dasatinib in Japanese patients with chronic myeloid leukemia or Philadelphia chromosome-positive acute lymphoblastic leukemia. Int J Hematol. 2009;89:332-341 pubmed publisher
    ..Dasatinib therapy resulted in high rates of hematologic and cytogenetic response, suggesting that dasatinib is promising as a new treatment for Japanese CML and Ph(+) ALL patients resistant or intolerant to imatinib. ..
  88. Watanuki J, Hatakeyama K, Sonoki T, Tatetsu H, Yoshida K, Fujii S, et al. Bone marrow large B cell lymphoma bearing cyclin D3 expression: clinical, morphologic, immunophenotypic, and genotypic analyses of seven patients. Int J Hematol. 2009;90:217-225 pubmed publisher
    ..Further studies are required to determine whether CCND3 expression is associated with a unique subset of diffuse large B cell lymphoma. ..
  89. Yanai H, Wani Y, Notohara K, Takada S, Yoshino T. Uterine leiomyosarcoma arising in leiomyoma: clinicopathological study of four cases and literature review. Pathol Int. 2010;60:506-9 pubmed publisher
  90. Sato Y, Kojima M, Takata K, Morito T, Mizobuchi K, Tanaka T, et al. Multicentric Castleman's disease with abundant IgG4-positive cells: a clinical and pathological analysis of six cases. J Clin Pathol. 2010;63:1084-9 pubmed publisher
    ..Laboratory findings, especially IL-6 level, C-reactive protein level and platelet count, are important for the differential diagnosis of the two diseases. ..
  91. Ennishi D, Maeda Y, Fujii N, Kondo E, Shinagawa K, Ikeda K, et al. Allogeneic hematopoietic stem cell transplantation for advanced extranodal natural killer/T-cell lymphoma, nasal type. Leuk Lymphoma. 2011;52:1255-61 pubmed publisher
    ..Allo-HSCT is a feasible and promising consolidation therapy for advanced and relapsed ENKL. The disease status before allo-HSCT is well associated with general outcome, and thus induction treatment is very important for this disease. ..
  92. Takata S, Takigawa N, Segawa Y, Kubo T, Ohashi K, Kozuki T, et al. STAT3 expression in activating EGFR-driven adenocarcinoma of the lung. Lung Cancer. 2012;75:24-9 pubmed publisher
    ..Two lung cancer cell lines that overexpressed pSTAT3 were equally sensitive to a JAK2/STAT3 inhibitor (JSI-124). The role of STAT3 in the progression of adenocarcinoma should be further pursued. ..