Napa

Summary

Gene Symbol: Napa
Description: NSF attachment protein alpha
Alias: alpha-SNAP, alpha-soluble NSF attachment protein, N-ethylmaleimide sensitive fusion protein attachment protein alpha, N-ethylmaleimide-sensitive factor attachment protein, alpha, SNAP-alpha
Species: rat
Products:     Napa

Top Publications

  1. Su Q, Mochida S, Tian J, Mehta R, Sheng Z. SNAP-29: a general SNARE protein that inhibits SNARE disassembly and is implicated in synaptic transmission. Proc Natl Acad Sci U S A. 2001;98:14038-43 pubmed
  2. Schmidt D, Messner E. The female hysterical personality disorder. J Fam Pract. 1977;4:573-7 pubmed
    ..Major emphasis is given to practical guidelines for the clinician for management of this frequently difficult problem in a medical setting. ..
  3. Wong S, Zhang T, Xu Y, Subramaniam V, Griffiths G, Hong W. Endobrevin, a novel synaptobrevin/VAMP-like protein preferentially associated with the early endosome. Mol Biol Cell. 1998;9:1549-63 pubmed
  4. Chae T, Allen K, Davisson M, Sweet H, Walsh C. Mapping of the mouse hyh gene to a YAC/BAC contig on proximal Chromosome 7. Mamm Genome. 2002;13:239-44 pubmed
    ..Our physical map and transcript map may be useful for positional cloning of genes in this unusually gene-rich region of the genome. ..
  5. Bock J, Klumperman J, Davanger S, Scheller R. Syntaxin 6 functions in trans-Golgi network vesicle trafficking. Mol Biol Cell. 1997;8:1261-71 pubmed
    ..Converging lines of evidence suggest that syntaxin 6 mediates a TGN trafficking event, perhaps targeting to endosomes in mammalian cells. ..
  6. Hanson P, Roth R, Morisaki H, Jahn R, Heuser J. Structure and conformational changes in NSF and its membrane receptor complexes visualized by quick-freeze/deep-etch electron microscopy. Cell. 1997;90:523-35 pubmed
    ..Together, these images suggest how NSF could dissociate the SNARE complex and how association and dissociation of the complex could be related to membrane fusion. ..
  7. Barszczewski M, Chua J, Stein A, Winter U, Heintzmann R, Zilly F, et al. A novel site of action for alpha-SNAP in the SNARE conformational cycle controlling membrane fusion. Mol Biol Cell. 2008;19:776-84 pubmed
    ..We conclude that alpha-SNAP inhibits exocytosis by binding to the syntaxin SNARE motif and in turn prevents SNARE assembly, revealing an unexpected site of action for alpha-SNAP in the SNARE cycle that drives exocytotic membrane fusion. ..
  8. Burgalossi A, Jung S, Meyer G, Jockusch W, Jahn O, Taschenberger H, et al. SNARE protein recycling by ?SNAP and ?SNAP supports synaptic vesicle priming. Neuron. 2010;68:473-87 pubmed publisher
    ..Our analysis of ?- and ?SNAP deletion mutant neurons shows that the two NSF cofactors support synaptic vesicle priming by determining the availability of free SNARE components, particularly during phases of high synaptic activity. ..
  9. Hanley J, Khatri L, Hanson P, Ziff E. NSF ATPase and alpha-/beta-SNAPs disassemble the AMPA receptor-PICK1 complex. Neuron. 2002;34:53-67 pubmed
    ..This demonstrates that the previously reported synaptic stabilization of AMPARs by NSF involves disruption of GluR2-PICK1 interactions. Furthermore, we are reporting a non-SNARE substrate for NSF disassembly activity. ..

More Information

Publications16

  1. Hong H, Chakravarti A, Takahashi J. The gene for soluble N-ethylmaleimide sensitive factor attachment protein alpha is mutated in hydrocephaly with hop gait (hyh) mice. Proc Natl Acad Sci U S A. 2004;101:1748-53 pubmed
    ..The hyh mutant provides a valuable in vivo model to study vesicle/membrane trafficking and provides insight into the potential roles of alpha-SNAP in embryogenesis and brain development. ..
  2. Chae T, Kim S, Marz K, Hanson P, Walsh C. The hyh mutation uncovers roles for alpha Snap in apical protein localization and control of neural cell fate. Nat Genet. 2004;36:264-70 pubmed
    ..mutation in the gene Napa encoding soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein alpha (alpha Snap), involved in SNAP receptor (SNARE)-mediated vesicle fusion in many cellular contexts...
  3. Martin H, Henley J, Meyer G. Novel putative targets of N-ethylmaleimide sensitive fusion protein (NSF) and alpha/beta soluble NSF attachment proteins (SNAPs) include the Pak-binding nucleotide exchange factor betaPIX. J Cell Biochem. 2006;99:1203-15 pubmed
    ..In summary, our results support the evolving view that NSF has numerous targets in addition to conventional SNARE complexes. ..
  4. Vivona S, Cipriano D, O Leary S, Li Y, Fenn T, Brunger A. Disassembly of all SNARE complexes by N-ethylmaleimide-sensitive factor (NSF) is initiated by a conserved 1:1 interaction between ?-soluble NSF attachment protein (SNAP) and SNARE complex. J Biol Chem. 2013;288:24984-91 pubmed publisher
    ..Subsequent additional ?-SNAP binding events may occur as part of a processive disassembly mechanism. ..
  5. Chen D, Li L, Yan J, Yang X, You Y, Zhou Y, et al. The loss of αSNAP downregulates the expression of occludin in the intestinal epithelial cell of acute pancreatitis model. Pancreatology. 2014;14:347-55 pubmed publisher
    ..Hence, the permeability of the intestinal barrier may be increased in a severe acute pancreatitis model. ..
  6. Jimenez A, Tome M, Paez P, Wagner C, Rodriguez S, Fernández Llebrez P, et al. A programmed ependymal denudation precedes congenital hydrocephalus in the hyh mutant mouse. J Neuropathol Exp Neurol. 2001;60:1105-19 pubmed
    ..The defect in these embryos also includes loss of the hindbrain floor plate and a delayed in the expression of Reissner fiber glycoproteins by the subcommissural organ. ..
  7. Xi Z, Deng W, Wang L, Xiao F, Li J, Wang Z, et al. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure. J Mol Neurosci. 2015;57:417-25 pubmed publisher
    ..In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals...