A L Andreu


Affiliation: Hospital Universitari Vall d'Hebron
Country: Spain


  1. pmc McArdle disease: molecular genetic update
    A L Andreu
    Dept Patologia Mitocondrial i Neuromuscular, Centre d Investigacions en Bioquimica i Biologia Molecular CIBBIM, Institut de Recerca Vall d Hebron, Barcelona, Spain
    Acta Myol 26:53-7. 2007
  2. ncbi request reprint Autosomal dominant limb-girdle muscular dystrophy: a large kindred with evidence for anticipation
    J Gamez
    Department of Neurology, Hospital Vall d Hebron, Barcelona, Spain
    Neurology 56:450-4. 2001
  3. ncbi request reprint Exercise intolerance resulting from a muscle-restricted mutation in the mitochondrial tRNA(Leu (CUN)) gene
    C Vives-Bauza
    Research Centre for Biochemistry and Molecular Biology, Universitary Hospital Vall d'Hebron, Barcelona, Spain
    Ann Med 33:493-6. 2001
  4. ncbi request reprint A novel autosomal dominant limb-girdle muscular dystrophy (LGMD 1F) maps to 7q32.1-32.2
    L Palenzuela
    Centre d Investigacions en Bioquimica i Biologia Molecular CIBBIM, Hospital Universitari Vall d Hebron, Barcelona, Spain
    Neurology 61:404-6. 2003
  5. ncbi request reprint Splicing mosaic of the myophosphorylase gene due to a silent mutation in McArdle disease
    I Fernandez-Cadenas
    Centre d Investigacions en Bioquímica y Biología Molecular, Hospital Universitari Vall d Hebron, Barcelona, Spain
    Neurology 61:1432-4. 2003
  6. ncbi request reprint Molecular genetics of McArdle's disease
    G Nogales-Gadea
    Dept Patologia Mitocondrial i Neuromuscular, Centre d Investigacions en Bioguimica y Bioloqía Molecular, Institut de Recera Vall d Hebron, Barcelona, Spain
    Curr Neurol Neurosci Rep 7:84-92. 2007
  7. doi request reprint Hematopoietic gene therapy restores thymidine phosphorylase activity in a cell culture and a murine model of MNGIE
    J Torres-Torronteras
    Laboratori of Neuromuscular and Mitochondrial Disorders, Institut de Recerca Hospital Universitari Vall d Hebron, Universitat Autonoma de Barcelona, Barcelona, Spain
    Gene Ther 18:795-806. 2011
  8. ncbi request reprint [Mitochondrial disorders: a classification for the 21st century]
    A L Andreu
    Centro de Investigaciones en Bioquimica y Biologia Molecular, Hospital Vall d Hebron, Barcelona, Spain
    Neurologia 19:15-22. 2004
  9. ncbi request reprint Genotype-phenotype correlation in the 5703G>A mutation in the tRNA(ASN) gene of mitochondrial DNA
    C Vives-Bauza
    Centre d Investigacions en Bioquimica i Biologia Molecular, Hospital Universitari Vall d Hebron, Barcelona, Spain
    J Inherit Metab Dis 26:507-8. 2003
  10. ncbi request reprint Peginterferon alpha-2b plus ribavirin vs interferon alpha-2b plus ribavirin for chronic hepatitis C in HIV-coinfected patients
    M Crespo
    Infectious Diseases Department, Hospital Universitari Vall d Hebron, Barcelona, Spain
    J Viral Hepat 14:228-38. 2007


  • M Buti
  • S Schwartz
  • M Hirano
  • J Arenas
  • J Montoya
  • C Navarro
  • Claudio Bruno
  • P Briones
  • R Fernandez
  • A Gomez
  • E Bonilla
  • J Quer
  • Josep Gamez
  • S DiMauro
  • A Lucia
  • M Pineda Marfa
  • M Filosto
  • R Garesse
  • M Mancuso
  • M A Martin
  • J C Rubio
  • I Fernandez-Cadenas
  • M Perez
  • L Palenzuela
  • R Marti
  • Y Campos
  • M C Lara
  • C Vives-Bauza
  • A Blazquez
  • J L Maté-Muñoz
  • G Nogales-Gadea
  • A Solano
  • C Cervera
  • J Torres-Torronteras
  • A Cabello
  • M R Vila
  • A Meseguer
  • A Playan
  • M Garcia-Ramirez
  • M Crespo
  • M Ramirez
  • D Llige
  • C Foster
  • F Gomez-Gallego
  • I Illa
  • G M Hadjigeorgiou
  • C Paradas
  • J Bautista
  • S Dimaur
  • M Roig
  • P Del Hoyo
  • J Barquinero
  • H Eixarch
  • G Pizzorno
  • R Simo
  • C Chamorro-Viña
  • C Hernandez
  • I Garcia-Consuegra
  • R Martinez
  • E Garcia-Arumi
  • M Fernández Del Valle
  • G Francisco
  • J Guardia
  • J Montaner
  • S Sauleda
  • M Moran
  • A Juarez
  • M Raspall-Chaure
  • I Ocana
  • E Ribera
  • I Ruiz
  • V Falco
  • M Roig-Quilis
  • R Esteban
  • C Cardona
  • J I Esteban
  • A Pahissa
  • A Perez-Martinez
  • J Esteve-Lanao
  • S J Fleck
  • B Weiss
  • J Garcia-Castro
  • Y Anikster
  • L Massuet
  • L Madero
  • P Madoz
  • M L Valentino
  • E Gallardo
  • O Belda
  • R A Wevers

Detail Information


  1. pmc McArdle disease: molecular genetic update
    A L Andreu
    Dept Patologia Mitocondrial i Neuromuscular, Centre d Investigacions en Bioquimica i Biologia Molecular CIBBIM, Institut de Recerca Vall d Hebron, Barcelona, Spain
    Acta Myol 26:53-7. 2007
    ..Molecular heterogeneity has been demonstrated by the identification to date of more than 65 mutations in the PYGM gene...
  2. ncbi request reprint Autosomal dominant limb-girdle muscular dystrophy: a large kindred with evidence for anticipation
    J Gamez
    Department of Neurology, Hospital Vall d Hebron, Barcelona, Spain
    Neurology 56:450-4. 2001
    ..Fourteen genetically distinct forms of limb-girdle muscular dystrophy (LGMD) have been identified, including five types of autosomal dominant LGMD (AD-LGMD)...
  3. ncbi request reprint Exercise intolerance resulting from a muscle-restricted mutation in the mitochondrial tRNA(Leu (CUN)) gene
    C Vives-Bauza
    Research Centre for Biochemistry and Molecular Biology, Universitary Hospital Vall d'Hebron, Barcelona, Spain
    Ann Med 33:493-6. 2001
    ..CONCLUSION: Mutations in any mitochondrial gene should be considered in the differential diagnosis of patients with lifelong exercise intolerance, even when the neurological examination is normal...
  4. ncbi request reprint A novel autosomal dominant limb-girdle muscular dystrophy (LGMD 1F) maps to 7q32.1-32.2
    L Palenzuela
    Centre d Investigacions en Bioquimica i Biologia Molecular CIBBIM, Hospital Universitari Vall d Hebron, Barcelona, Spain
    Neurology 61:404-6. 2003
    ..1-32.2. Within this chromosomal region, filamin C, a gene encoding actin binding protein highly expressed in muscle, was an obvious candidate gene; however, the authors did not detect any defects in filamin C or its protein product...
  5. ncbi request reprint Splicing mosaic of the myophosphorylase gene due to a silent mutation in McArdle disease
    I Fernandez-Cadenas
    Centre d Investigacions en Bioquímica y Biología Molecular, Hospital Universitari Vall d Hebron, Barcelona, Spain
    Neurology 61:1432-4. 2003
    ..These findings suggest that, in patients with McArdle disease in whom no pathogenic mutation has been found, any a priori silent polymorphism should be re-evaluated as a putative splicing mutation...
  6. ncbi request reprint Molecular genetics of McArdle's disease
    G Nogales-Gadea
    Dept Patologia Mitocondrial i Neuromuscular, Centre d Investigacions en Bioguimica y Bioloqía Molecular, Institut de Recera Vall d Hebron, Barcelona, Spain
    Curr Neurol Neurosci Rep 7:84-92. 2007
    ..There is not a specific treatment for McArdle's disease, but some nutritional treatments in combination with aerobic conditioning could improve the quality of life in most patients...
  7. doi request reprint Hematopoietic gene therapy restores thymidine phosphorylase activity in a cell culture and a murine model of MNGIE
    J Torres-Torronteras
    Laboratori of Neuromuscular and Mitochondrial Disorders, Institut de Recerca Hospital Universitari Vall d Hebron, Universitat Autonoma de Barcelona, Barcelona, Spain
    Gene Ther 18:795-806. 2011
    ..Our results suggest that hematopoietic gene therapy could be an alternative treatment for this devastating disorder in the future...
  8. ncbi request reprint [Mitochondrial disorders: a classification for the 21st century]
    A L Andreu
    Centro de Investigaciones en Bioquimica y Biologia Molecular, Hospital Vall d Hebron, Barcelona, Spain
    Neurologia 19:15-22. 2004
    ..Alterations in those genes may be point mutations, deletions or duplications in the mitochondrial DNA and alterations of the genomic signaling between nucleus and mitochondria...
  9. ncbi request reprint Genotype-phenotype correlation in the 5703G>A mutation in the tRNA(ASN) gene of mitochondrial DNA
    C Vives-Bauza
    Centre d Investigacions en Bioquimica i Biologia Molecular, Hospital Universitari Vall d Hebron, Barcelona, Spain
    J Inherit Metab Dis 26:507-8. 2003
    ..We report a second patient with the same mutation and phenotype...
  10. ncbi request reprint Peginterferon alpha-2b plus ribavirin vs interferon alpha-2b plus ribavirin for chronic hepatitis C in HIV-coinfected patients
    M Crespo
    Infectious Diseases Department, Hospital Universitari Vall d Hebron, Barcelona, Spain
    J Viral Hepat 14:228-38. 2007
    ..Frequent monitoring of virological response may be very helpful to optimize treatment compliance, to tailor treatment duration and to minimize side effects...
  11. ncbi request reprint Phenotypic variability in a Spanish family with MNGIE
    J Gamez
    Department of Neurology, Hospital Gral, Vall d Hebron, Barcelona, Spain
    Neurology 59:455-7. 2002
    ..The first thymidine phosphorylase mutation identified in Spain showed phenotypic variability at onset...
  12. ncbi request reprint Reduced mitochondrial DNA transcription in senescent rat heart
    A L Andreu
    Centre d Investigacions en Bioquímica i Biologia Molecular dels Hospitals Vall d Hebrón, P Vall d Hebrón 119 125, Barcelona, E 08035, Spain
    Biochem Biophys Res Commun 252:577-81. 1998
    ..This reduction in the mtDNA transcriptional rate in the heart of senescent animals suggests that this could be one of the molecular bases underlying senescence of the myocardium...
  13. ncbi request reprint A new mutation in the regulatory domain of the myophosphorylase gene affecting protein dimer contact
    J Gamez
    Department of Neurology, Hospitals Vall d Hebron, Barcelona, Spain
    Muscle Nerve 22:1136-8. 1999
    ..These data further emphasize the importance of private mutations in McArdle's disease, some of which are associated with specific ethnic groups...
  14. doi request reprint Mitochondrial DNA oxidation and manganese superoxide dismutase activity in peripheral blood mononuclear cells from type 2 diabetic patients
    M Garcia-Ramirez
    CIBERDEM ISCIII and Diabetes Research Unit, Institut de Recerca, Hospital Universitari Vall d Hebron, Universitat Autonoma de Barcelona, Barcelona, Spain
    Diabetes Metab 34:117-24. 2008
    ..To investigate the balance between parameters of oxidative stress and antioxidant defences in the mitochondria of peripheral blood mononuclear cells (PBMCs) of type 2 diabetic patients with late complications...
  15. pmc Familial expansile osteolysis in a large Spanish kindred resulting from an insertion mutation in the TNFRSF11A gene
    L Palenzuela
    Centre d Investigacions en Bioquimica i Biologia Molecular CIBBIM, Hospital Universitari Vall d Hebron, Barcelona, Spain
    J Med Genet 39:E67. 2002
  16. ncbi request reprint [Mitochondrial encephalopathies: where are we going?]
    S DiMauro
    H Houston Merritt Clinical Research Center for Muscular Dystrophy and Related Diseases, New York, NY, USA
    Rev Neurol 28:164-8. 1999
    ..The molecular base of nDNA mutations; 3. The coenzyme Q10 deficiency; 4. Defects of translocases; 5. Defects of mitochondrial protein importation, and 6. Defects of intergemonic signalling...
  17. ncbi request reprint A new mutation in the myophosphorylase gene (Asn684Tyr) in a Spanish patient with McArdle's disease
    A L Andreu
    H Houston Merritt Clinical Research Center for Muscular Dystrophy and Related Diseases, Department of Neurology, College of Physicians and Surgeons, New York, NY 10032, USA
    Neuromuscul Disord 9:171-3. 1999
  18. ncbi request reprint Variable presentation of the clinical phenotype of McArdle's disease in a kindred harbouring a novel compound genotype in the muscle glycogen phosphorylase gene
    C Paradas
    Unidad de Neurologia, Hospital de Zafra, Badajoz, Spain
    Neurosci Lett 391:28-31. 2005
    ..Our results indicate no association of the I/D ACE trait in this family, suggesting that other factors would be more relevant in determining the severity of the clinical presentation...
  19. ncbi request reprint Lack of gastrointestinal symptoms in a 60-year-old patient with MNGIE
    M A Martin
    Centro de Investigacion, Hospital Universitario 12 de Octubre, Madrid, Spain
    Neurology 63:1536-7. 2004
  20. pmc A mitochondrial DNA duplication as a marker of skeletal muscle specific mutations in the mitochondrial genome
    M Mancuso
    J Med Genet 41:e73. 2004
  21. ncbi request reprint A novel missense mutation (W797R) in the myophosphorylase gene in Spanish patients with McArdle disease
    R Fernandez
    H Houston Merritt Clinical Research Center for Muscular Dystrophy and Related Diseases, Department of Neurology, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA
    Arch Neurol 57:217-9. 2000
    ..To investigate the degree of genetic heterogeneity of myophosphorylase deficiency (McArdle disease) in Spain through molecular studies of 10 new patients...
  22. ncbi request reprint Molecular heterogeneity of myophosphorylase deficiency (McArdle's disease): a genotype-phenotype correlation study
    M A Martin
    Centro de Investigación y Sección de Neuropatología, Hospital Universitario 12 de Octubre, Madrid, Spain
    Ann Neurol 50:574-81. 2001
    ..The mutations of charged residues would be expected to interfere with internal hydrogen bonding networks, introducing severe incompatible partnering that is caused by poor packing or electrostatic repulsions...
  23. ncbi request reprint Myophosphorylase deficiency (glycogenosis type V; McArdle disease)
    S Dimaur
    Department of Neurology, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA
    Curr Mol Med 2:189-96. 2002
    ..Mutations are spread throughout the gene and there is no clear genotype:phenotype correlation. High-protein diet and aerobic exercise are beneficial, and gene therapy appears promising...
  24. ncbi request reprint McArdle disease: another systemic low-inflammation disorder?
    Alejandro Lucia
    Universidad Europea de Madrid, 28670 Madrid, Spain
    Neurosci Lett 431:106-11. 2008
    ..Our results support the rationale for prescribing carefully supervised exercise training in these patients...
  25. ncbi request reprint [Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)]
    A Playan
    Departamento de Bioquímica y Biología Molecular y Celular Universidad de Zaragoza, Zaragoza, Espana
    Rev Neurol 34:1124-6. 2002
    ..Leigh syndrome is also caused by a second mutation in the same position T8993C...
  26. ncbi request reprint [Private mutations in the myophosphorylase gene: the first case in a patient of Latin American descent]
    I Fernandez-Cadenas
    Universidad de Zaragoza, 50013 Zaragoza, Espana
    Rev Neurol 45:280-3. 2007
    ..McArdle's disease (glycogenoses type V) is a common metabolic myopathy caused by deficient myophosphorylase activity. The disease is due to mutations in the myophosphorylase (PYGM) gene and is present in a large number of countries...
  27. ncbi request reprint AMPD1 genotypes and exercise capacity in McArdle patients
    J C Rubio
    Centro de Investigacion, Hospital Universitario 12 de Octubre, Madrid, Spain
    Int J Sports Med 29:331-5. 2008
  28. ncbi request reprint Mutations in mitochondrial DNA as a cause of exercise intolerance
    S DiMauro
    Department of Neurology, Columbia University College of Physicians and Surgeons, New York, NY, USA
    Ann Med 33:472-6. 2001
    ..Contrary to the general rules of mitochondrial genetics, all patients were sporadic cases and all mutations were restricted to skeletal muscle, suggesting that they were somatic mutations not affecting the germ line...
  29. ncbi request reprint Reversion of mtDNA depletion in a patient with TK2 deficiency
    M R Vila
    Department of Neurology, Columbia University College of Physicians and Surgeons New York, NY, USA
    Neurology 60:1203-5. 2003
    ..This report extends the phenotypic expression of primary TK2 deficiency and suggests that factors other than TK2 may modify expression of the clinical phenotype in patients with MDS syndrome...
  30. pmc Can patients with McArdle's disease run?
    M Perez
    Universidad Europea de Madrid, Madrid, Spain
    Br J Sports Med 41:53-4. 2007
    ..These preliminary data suggest the potential therapeutic value of this type of exercise in these patients...
  31. ncbi request reprint Infusion of platelets transiently reduces nucleoside overload in MNGIE
    M C Lara
    Laboratori de Patologia Neuromuscular i Mitocondrial, Institut de Recerca Hospital Universitari Vall d Hebron, Pg Vall d Hebron 119, 08035 Barcelona, Spain
    Neurology 67:1461-3. 2006
  32. pmc Exercise capacity in a 78 year old patient with McArdle's disease: it is never too late to start exercising
    M Perez
    Universidad Europea de Madrid, Madrid, Spain
    Br J Sports Med 40:725-6; discussion 726. 2006
    ..The data suggest that, with pre-exercise sucrose administration, such patients may be candidates for systematic reconditioning, which may improve functional capacity and quality of life...
  33. pmc Mobilisation of mesenchymal cells into blood in response to skeletal muscle injury
    M Ramirez
    Servicio de Oncohematología y Transplante, Hospital Universitario Nino Jesus, Avda Menéndez Pelayo 65, 28009 Madrid, Spain
    Br J Sports Med 40:719-22. 2006
    ..These two models (acute and chronic) would be of value in the search for molecular mediators of mobilisation of MSCs into the circulation...
  34. ncbi request reprint Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE
    A Blazquez
    Centro de Investigación and Sección de Neuropatología, Hospital Universitario 12 de Octubre, Madrid, Spain
    Neuromuscul Disord 15:775-8. 2005
    ..1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP)...
  35. pmc Characterisation of repeat and palindrome elements in patients harbouring single deletions of mitochondrial DNA
    A Solano
    Departamento de Bioquimica y Biologia Molecular y Celular, Universidad de Zaragoza, Zaragoza, Spain
    J Med Genet 40:e86. 2003
  36. ncbi request reprint Diseases of oxidative phosphorylation due to mtDNA mutations
    S DiMauro
    Department of Neurology, Columbia University College of Physicians and Surgeons, New York, New York 10032, USA
    Semin Neurol 21:251-60. 2001
  37. ncbi request reprint A new mtDNA mutation in the tRNA(Leu(UUR)) gene associated with ocular myopathy
    Y Campos
    , Hospital 12 de Octubre, , 28041, Madrid, Spain
    Neuromuscul Disord 11:477-80. 2001
    ..The T3273C mutation affects a strictly conserved base pair in the anticodon stem and was not found in controls, thus satisfying the accepted criteria for pathogenicity...
  38. ncbi request reprint Manifesting heterozygotes in a Japanese family with a novel mutation in the muscle-specific phosphoglycerate mutase (PGAM-M) gene
    G M Hadjigeorgiou
    Department of Neurology, H Houston Merritt Clinical Research Center for Muscular Dystrophy and Related Diseases, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA
    Neuromuscul Disord 9:399-402. 1999
    ..Two heterozygous family members for the G97D mutation presented with exercise intolerance and muscle cramps. We describe the first PGAM-M mutation in the Japanese population and confirm that heterozygous individuals can be symptomatic...
  39. ncbi request reprint Molecular analysis of myophosphorylase deficiency in Dutch patients with McArdle's disease
    M A Martin
    Centro de Investigacion, Hospital Universitario 12 de Octubre, Madrid, Spain
    Ann Hum Genet 68:17-22. 2004