A L Andreu

..Molecular heterogeneity has been demonstrated by the identification to date of more than 65 mutations in the PYGM gene...

..Fourteen genetically distinct forms of limb-girdle muscular dystrophy (LGMD) have been identified, including five types of autosomal dominant LGMD (AD-LGMD)...

..CONCLUSION: Mutations in any mitochondrial gene should be considered in the differential diagnosis of patients with lifelong exercise intolerance, even when the neurological examination is normal...

..1-32.2. Within this chromosomal region, filamin C, a gene encoding actin binding protein highly expressed in muscle, was an obvious candidate gene; however, the authors did not detect any defects in filamin C or its protein product...

..These findings suggest that, in patients with McArdle disease in whom no pathogenic mutation has been found, any a priori silent polymorphism should be re-evaluated as a putative splicing mutation...

..There is not a specific treatment for McArdle's disease, but some nutritional treatments in combination with aerobic conditioning could improve the quality of life in most patients...

..Our results suggest that hematopoietic gene therapy could be an alternative treatment for this devastating disorder in the future...

..Alterations in those genes may be point mutations, deletions or duplications in the mitochondrial DNA and alterations of the genomic signaling between nucleus and mitochondria...

..We report a second patient with the same mutation and phenotype...

..Frequent monitoring of virological response may be very helpful to optimize treatment compliance, to tailor treatment duration and to minimize side effects...

..The first thymidine phosphorylase mutation identified in Spain showed phenotypic variability at onset...

..This reduction in the mtDNA transcriptional rate in the heart of senescent animals suggests that this could be one of the molecular bases underlying senescence of the myocardium...

..These data further emphasize the importance of private mutations in McArdle's disease, some of which are associated with specific ethnic groups...

..To investigate the balance between parameters of oxidative stress and antioxidant defences in the mitochondria of peripheral blood mononuclear cells (PBMCs) of type 2 diabetic patients with late complications...

..The molecular base of nDNA mutations; 3. The coenzyme Q10 deficiency; 4. Defects of translocases; 5. Defects of mitochondrial protein importation, and 6. Defects of intergemonic signalling...

....

..Our results indicate no association of the I/D ACE trait in this family, suggesting that other factors would be more relevant in determining the severity of the clinical presentation...

..To investigate the degree of genetic heterogeneity of myophosphorylase deficiency (McArdle disease) in Spain through molecular studies of 10 new patients...

..The mutations of charged residues would be expected to interfere with internal hydrogen bonding networks, introducing severe incompatible partnering that is caused by poor packing or electrostatic repulsions...

..Mutations are spread throughout the gene and there is no clear genotype:phenotype correlation. High-protein diet and aerobic exercise are beneficial, and gene therapy appears promising...

..Our results support the rationale for prescribing carefully supervised exercise training in these patients...

..McArdle's disease (glycogenoses type V) is a common metabolic myopathy caused by deficient myophosphorylase activity. The disease is due to mutations in the myophosphorylase (PYGM) gene and is present in a large number of countries...

....

..Contrary to the general rules of mitochondrial genetics, all patients were sporadic cases and all mutations were restricted to skeletal muscle, suggesting that they were somatic mutations not affecting the germ line...

..This report extends the phenotypic expression of primary TK2 deficiency and suggests that factors other than TK2 may modify expression of the clinical phenotype in patients with MDS syndrome...

..These preliminary data suggest the potential therapeutic value of this type of exercise in these patients...

....

..The data suggest that, with pre-exercise sucrose administration, such patients may be candidates for systematic reconditioning, which may improve functional capacity and quality of life...

..1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP)...

....

..The T3273C mutation affects a strictly conserved base pair in the anticodon stem and was not found in controls, thus satisfying the accepted criteria for pathogenicity...

..Two heterozygous family members for the G97D mutation presented with exercise intolerance and muscle cramps. We describe the first PGAM-M mutation in the Japanese population and confirm that heterozygous individuals can be symptomatic...